krit.club logo

Molecular Basis of Inheritance - Transcription

Grade 12CBSEBiology

Review the key concepts, formulae, and examples before starting your quiz.

🔑Concepts

Transcription is the process of copying genetic information from one strand of the DNADNA into RNARNA. It is governed by the principle of complementarity, except that adenosine forms a base pair with UracilUracil (UU) instead of ThymineThymine (TT).

A Transcription Unit in DNADNA is defined primarily by three regions: a Promoter (located towards 55'-end of the coding strand), the Structural gene, and a Terminator (located towards 33'-end of the coding strand).

The enzyme DNADNA-dependent RNARNA polymerase catalyzes the polymerization in only one direction, i.e., 535' \rightarrow 3'. Consequently, the strand with 353' \rightarrow 5' polarity acts as the Template Strand.

The strand with 535' \rightarrow 3' polarity is called the Coding Strand. Its sequence is identical to the synthesized RNARNA, except for the substitution of TT by UU.

In Prokaryotes, transcription requires the initiation factor (σ\sigma factor) and termination factor (ρ\rho factor) to start and stop the process respectively. Translation can often begin before the mRNAmRNA is fully transcribed.

In Eukaryotes, there are three types of RNARNA polymerases: RNA polymerase IRNA \ polymerase \ I (transcribes rRNAsrRNAs like 28S28S, 18S18S, and 5.8S5.8S), RNA polymerase IIRNA \ polymerase \ II (transcribes hnRNAhnRNA), and RNA polymerase IIIRNA \ polymerase \ III (transcribes tRNAtRNA, 5S rRNA5S \ rRNA, and snRNAssnRNAs).

Post-transcriptional modifications in eukaryotes involve Splicing (removal of non-coding intronsintrons), Capping (addition of methyl guanosine triphosphatemethyl \ guanosine \ triphosphate at 55' end), and Tailing (addition of 200300200-300 adenylateadenylate residues at 33' end).

📐Formulae

3Template Strand53' \xrightarrow{\text{Template Strand}} 5'

5Coding Strand35' \xrightarrow{\text{Coding Strand}} 3'

5mRNA/Transcript35' \xrightarrow{\text{mRNA/Transcript}} 3'

Base Pairing Rules: AU, TA, GC\text{Base Pairing Rules: } A \rightarrow U, \ T \rightarrow A, \ G \rightleftharpoons C

💡Examples

Problem 1:

If the sequence of the coding strand in a transcription unit is written as follows: 5ATGCATGCATGCATGCATGCATGCATGC35'-ATGCATGCATGCATGCATGCATGCATGC-3'. Write down the sequence of mRNAmRNA.

Solution:

5AUGCAUGCAUGCAUGCAUGCAUGCAUGC35'-AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3'

Explanation:

The sequence of mRNAmRNA is exactly the same as the coding strand, with the only difference being that ThymineThymine (TT) is replaced by UracilUracil (UU). The polarity remains 535' \rightarrow 3'.

Problem 2:

Given a template strand sequence 3TACGTACGTACGTACG53'-TACGTACGTACGTACG-5', deduce the sequence of the transcribed RNARNA.

Solution:

5AUGCUGCUGCUGCUGC35'-AUGCUGCUGCUGCUGC-3' (Corrected: 5AUGCUGCUGCUGCUGC35'-AUGCUGCUGCUGCUGC-3' based on complementarity: AA pairs with UU, TT pairs with AA, GG with CC, CC with GG)

Explanation:

Since the template strand is 353' \rightarrow 5', the RNARNA polymerase will synthesize a complementary strand in the 535' \rightarrow 3' direction. Using the base pairing rule (TAT \rightarrow A, AUA \rightarrow U, CGC \rightarrow G, GCG \rightarrow C), we obtain the sequence.